Gene Correlation

Problem Description

To learn about the functional and structural similarity of gene sequences, biologists often align several different DNA sequences to judge whether the compared DNA is correlated.

Now align two DNA sequences of the same length. First, define the two bases at the same position of the two sequences as a base pair; if the two bases in a base pair are identical, it is called a matching base pair. Then compute the ratio of matching base pairs to the total number of base pairs. If this ratio is greater than or equal to a given threshold, the two DNA sequences are judged to be correlated; otherwise they are not.

Input Format

There are three lines. The first line is the threshold used to decide whether the two DNA sequences are correlated. The following $2$ lines are the two DNA sequences (length not greater than $500$, consisting only of the letters $A,T,C,G$).

Output Format

If the two DNA sequences are correlated, output yes; otherwise output no.

Sample Input

0.85
ATCGCCGTAAGTAACGGTTTTAAATAGGCC
ATCGCCGGAAGTAACGGTCTTAAATAGGCC

Sample Output

yes